Installation

Ktrim is written in C++ for GNU Linux/Unix platforms. After uncompressing the source package, you can find an executable file ktrim under bin/ directory compiled using G++ v4.8.5 for Linux x86_64 system. If you could not run it (which is usually caused by low version of libc++ library) or you want to build a version optimized for your system, you can re-compile the programs:

  1. user@linux$ make clean && make

Run Ktrim

The main program is ktrim under bin/ directory. You can add its path to your ~/.bashrc file under the PATH variable to call it from anywhere; or you can run the following command to add it to your current session:

  1. user@linux$ PATH=$PATH:$PWD/bin/

You can also add ktrim to your system to call it from anywhere and share with other users (requires root privilege):

  1. user@linux# make install

Call ktrim without any parameters to see the usage (or use ‘-h’ option):

  1. Usage: Ktrim [options] -1/-U Read1.fq [ -2 Read2.fq ] -o out.prefix
  3. Author : Kun Sun (sunkun@szbl.ac.cn)
  4. Version: 1.1.0 (Feb 2020)
  6. Ktrim is designed to perform adapter- and quality-trimming of FASTQ files.
  8. Compulsory parameters:
  10.   -1/-U Read1.fq  Specify the path to the files containing read 1
  11.                   If your data is Paired-end, use '-1' and specify read 2 files using '-2' option
  12.                   Note that if '-U' is used, specification of '-2' is invalid
  13.                   If you have multiple files for your sample, use ',' to separate them
  15.   -o out.prefix   Specify the prefix of the output files
  16.                   Note that output files include trimmed reads in FASTQ format and statistics
  18. Optional parameters:
  20.   -2 Read2.fq     Specify the path to the file containing read 2
  21.                   Use this parameter if your data is generated in paired-end mode
  22.                   If you have multiple files for your sample, use ',' to separate them
  23.                   and make sure that all the files are well paired in '-1' and '-2' options
  25.   -t threads      Specify how many threads should be used (default: 1, single-thread)
  26.                   You can set '-t' to 0 to use all threads (automatically detected)
  28.   -p phred-base   Specify the baseline of the phred score (default: 33)
  29.   -q score        The minimum quality score to keep the cycle (default: 20)
  30.                   Note that 20 means 1% error rate, 30 means 0.1% error rate in Phred
  32.                   Phred 33 ('!') and Phred 64 ('@') are the most widely used scoring system
  33.                   while quality scores start from 35 ('#') in the FASTQ files is also common
  35.   -s size         Minimum read size to be kept after trimming (default: 36)
  37.   -k kit          Specify the sequencing kit to use built-in adapters
  38.                   Currently supports 'Illumina' (default), 'Nextera', 'Transposase' and 'BGI'
  39.   -a sequence     Specify the adapter sequence in read 1
  40.   -b sequence     Specify the adapter sequence in read 2
  41.                   If '-a' is set while '-b' is not, I will assume that read 1 and 2 use same adapter
  42.                   Note that '-k' option has a higher priority (when set, '-a'/'-b' will be ignored)
  44.   -m proportion   Set the proportion of mismatches allowed during index and sequence comparison
  45.                   Default: 0.125 (i.e., 1/8 of compared base pairs)
  47.   -h/--help       Show this help information and quit
  48.   -v/--version    Show the software version and quit
  50. Please refer to README.md file for more information (e.g., setting adapters).
  52. Ktrim: extra-fast and accurate adapter- and quality-trimmer.

Ktrim contains built-in adapter sequences used by Illumina TruSeq kits, Nextera kits, Nextera transposase adapters and BGI sequencing kits within the package. However, customized adapter sequences are also allowed by setting ‘-a’ (for read 1) and ‘-b’ (for read 2; if it is the same as read 1, you can leave it blank) options. You may need to refer to the manual of your library preparation kit for the adapter sequences. Note that in the current version of Ktrim, only 1 pair of adapters is allowed.

The following is the built-in adapter sequences (the copyright should belong to the corresponding companies):

  1. Illumina TruSeq kits:
  2. AGATCGGAAGAGC (for both read 1 and read 2)
  4. Nextera kits:
  5. CTGTCTCTTATACACATCT (for both read 1 and read 2)
  7. Nextera transposase adapters:
  8. Read 1: TCGTCGGCAGCGTC
  9. Read 2: GTCTCGTGGGCTCG
  11. BGI adapters:
  12. Read 1: AAGTCGGAGGCCAAGCGGTC
  13. Read 2: AAGTCGGATCGTAGCCATGT

Example 1

Your data is generated using Illumina TruSeq kit in Single-end mode, then you can run:

  1. user@linux$ ktrim -U /path/to/read1.fq -o /path/to/output/dir

Example 2

Your data is generated using a kit with customized adapters; your data is composed of 3 lanes in Paired-end mode and uses Phred scoring system starts from 35; you want to keep the high quality (Phred score >=30) bases and reads longer than 50 bp after trimming; and you want to use 4 threads to speed-up the analysis, then you can run:

  1. user@linux$ ktrim -1 /path/to/lane1.read1.fq,/path/to/lane2.read1.fq,/path/to/lane3.read1.fq \
  2.                   -2 /path/to/lane1.read2.fq,/path/to/lane2.read2.fq,/path/to/lane3.read2.fq \
  3.                   -t 4 -p 35 -q 30 -s 50 -o /path/to/output/dir \
  4.                   -a READ1_ADAPTER_SEQUENCE -b READ2_ADAPTER_SEQUENCE

Testing dataset

Under the testing_dataset/ directory, a script named simu.reads.pl is provided to generate in silico reads for testing purpose only. Note that the results in the paper is based on the data generated by this script. Another script check.accuracy.pl is designed to evaluate the accuracies of the trimming tools.

Please refer to the Supplementary Method for reproducing the results in the paper.

Outputs explanation

Ktrim outputs the trimmed reads in FASTQ format and key statistics (e.g., the numbers of reads that contains adapters and the number of reads in the trimmed files).

Citation

When referencing, please cite “Sun K (2020) Ktrim: an extra-fast and accurate adapter- and quality-trimmer for sequencing data. Bioinformatics in press“.

Please send bug reports to Kun Sun (sunkun@szbl.ac.cn).
Ktrim is freely available at https://github.com/hellosunking/Ktrim/.